rabbit polyclonal anti e coli antibody  (Bio-Rad)

Journal: eLife

Article Title: Control of pili synthesis and putrescine homeostasis in Escherichia coli

doi: 10.7554/eLife.102439

Figure Lengend Snippet: ( A ) The diagram shows the genes for the FimB and FimE recombinases, the invertible fimS region which contains the promoter for the fim operon, and the fim operon which codes for the proteins of the type 1 pilus. Primer pairs 1–2 and 1–3 detect the fimS region in the phase OFF and ON orientations, respectively. The DNA sizes for phases OFF and ON are 884 and 394, respectively, for wild-type strains of E. coli , such as MG1655. Our lab strain of W3110 has an IS1 element insertion in fimE which increases the size of the amplified DNA fragment. MG1655 was analyzed as a control. Primer 1 is 5’- CCGCGATGCTTTCCTCTATG -3’; primer 2 is 5’- TAATGACGCCCTGAAATTGC -3’; and primer 3 is 5’- TGCTAACTGGAAAGGCGCTG -3’ (shown schematically). ( B ) Deletion of either speB or hns had no effect on fimS orientation. A possible explanation for the loss of pili or PDSM in the speB or hns mutants is locking the fimS switch in phase OFF. However, loss of either speB or hns had no effect on fimS orientation in W3110 (lanes 2–4), and putrescine did not alter fimS orientation of the W3110 ΔspeB mutant (lanes 6 and 7). We conclude that loss of speB in W3110 did not phase-lock fimS in phase OFF. Also note that W3110, which has an insertion in fimE , is not locked in phase ON.

Article Snippet: Antibody , anti- E. coli RpoD (rabbit polyclonal) , Cusabio , Cat #: CSB-PA360419XA01ENV RRID: AB_3678626 , 1:10,000.

Techniques: Amplification, Control, Mutagenesis

Journal: eLife

Article Title: Control of pili synthesis and putrescine homeostasis in Escherichia coli

doi: 10.7554/eLife.102439

Figure Lengend Snippet:

Article Snippet: Antibody , anti- E. coli RpoD (rabbit polyclonal) , Cusabio , Cat #: CSB-PA360419XA01ENV RRID: AB_3678626 , 1:10,000.

Techniques: Transduction, Virus, Sequencing, Ligation, Isolation, Bacteria, Software

Journal: ACS Sensors

Article Title: Capacitive Biosensor for Rapid Detection of Avian (H5N1) Influenza and E. coli in Aerosols

doi: 10.1021/acssensors.4c03087

Figure Lengend Snippet: The performance of the capacitive biosensor for H5N1 and E. coli . We evaluated the sensitivity of the capacitive biosensors for (A) H5N1 and (B) E. coli using serial dilutions of the targets in PBS. Both biosensors showed well-defined linear response ( R 2 ≥ 0.95) to the log concentration of their respective targets. The normalized ΔC% was statistically significant (t-distribution, p < 0.01) indicating that the capacitance of different doses of the targets were statistically differentiated. We also assessed the specificity of (C) H5N1 and (D) E. coli . The signals for both targets, at concentration just above their LoDs (dashed blue line represents LoD signal), were significantly larger than those of interferences even at high concentrations, demonstrating that non-specific pathogens did not affect the capacitive biosensors.

Article Snippet: The H5N1 aptamer with 5′-amino was purchased from Creative Biolabs (Shirley, NY), and the rabbit polyclonal anti- E. coli antibody was purchased from Bio-Rad Laboratories (Hercules, CA).

Techniques: Concentration Assay

Journal: ACS Sensors

Article Title: Capacitive Biosensor for Rapid Detection of Avian (H5N1) Influenza and E. coli in Aerosols

doi: 10.1021/acssensors.4c03087

Figure Lengend Snippet: Quasi-quantification of H5N1 and E. coli aerosols by the capacitive biosensor integrated with the wet cyclone bioaerosol sampler. (A) The flowchart of the process for quasi-quantification and (B) The quasi-quantification to screen H5N1 and E. coli aerosols collected by the wet cyclone air sampler. The capacitive biosensor screened diluted samples, with results displayed as positive (Ο) or negative (X) based on normalized ΔC% relative to the LoDs of each target.

Article Snippet: The H5N1 aptamer with 5′-amino was purchased from Creative Biolabs (Shirley, NY), and the rabbit polyclonal anti- E. coli antibody was purchased from Bio-Rad Laboratories (Hercules, CA).

Techniques: